Journal: PLoS Pathogens

Article Title: Nuclear PYHIN proteins target the host transcription factor Sp1 thereby restricting HIV-1 in human macrophages and CD4+ T cells

doi: 10.1371/journal.ppat.1008752

Figure Lengend Snippet: Endogenous IFI16 inhibits HIV-1 in primary CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post-activation, cells were transfected with Cas9 in complex with either a non-targeting (nt) or an IFI16-specific gRNA. At 96 hours post-transfection, cells were transduced with the indicated VSV-G pseudotyped HIV-1 strains. (A-D) The reduction of IFI16 protein levels in infected cell cultures (A), the infectious virus yield (B), p24 antigen production (C) and levels of viral RNA transcripts (D) were determined by Western blot, TZM-bl infection assay, ELISA and qRT-PCR, respectively, three days post infection. Bar diagrams in panel A and D show mean values (±SD) of the three different donors; those in panel B and C from triplicate measurements. Numbers above bars indicate n-fold change between cells treated with control or IFI16 specific gRNA. * p <0.05, ** p <0.01, *** p <0.001. (E) Association of Sp1 and IFI16 by in situ PLA. (F) Sp1 co-precipitates with IFI16 and PYHIN in CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post activation, cells were lysed and endogenous Sp1 was immunoprecipitated using magnetic beads coated with either an Sp1 antibody or control IgG. Co-IP eluates and input controls were subsequently analysed by Western Blotting. Shown is the blot of one representative experiment. On the right-hand panel, the IFI16 signal intensity from three independent experiment (±SEM) is shown.

Article Snippet: Alternatively, 1*10 6 cells were transfected with the HiFi Cas9 Nuclease V3 (IDT)/gRNA complex (80 pmol/300 pml) (Lonza) using a non-targeting (IDT (ACGGAGGCTAAGCGTCGCAA)) or an IFI16-specific (IDT (GACCAGCCCTATCAAGAAAG)) sgRNAs, using the Amaxa 4D-Nucleofector Human Activated T Cell P3 Lonza Kit (Lonza), pulse code EO115.

Techniques: Isolation, Activation Assay, Transfection, Transduction, Infection, Virus, Western Blot, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Control, In Situ, Immunoprecipitation, Magnetic Beads, Co-Immunoprecipitation Assay

Journal: bioRxiv

Article Title: Genome wide CRISPR screen for Pasteurella multocida toxin (PMT) binding proteins reveals LDL Receptor Related Protein1 (LRP1) as crucial cellular receptor

doi: 10.1101/2022.08.04.502755

Figure Lengend Snippet: Mouse embryonic fibroblasts (MEF) stably expressing Flag-Cas9-EGFP were transduced with a lentiviral CRISPR-library. Cells were treated three times with PMT(C1165S)DTa and surviving cells grown. Genomic DNA was extracted, inserted sgRNA amplified and sequenced.

Article Snippet: We utilized a well-functioning and validate genome-wide mouse lentiviral CRISPR guide RNA library v2 (Addgene).

Techniques: Stable Transfection, Expressing, Transduction, CRISPR, Amplification

Journal: bioRxiv

Article Title: Genome wide CRISPR screen for Pasteurella multocida toxin (PMT) binding proteins reveals LDL Receptor Related Protein1 (LRP1) as crucial cellular receptor

doi: 10.1101/2022.08.04.502755

Figure Lengend Snippet: The volcano plot shows gene expression changes between cells treated with lethal PMT-DTa chimera and those only transduced with the CRISPR library. All reads were mapped locally using BWA-MEM [ ,6], then quantified with featureCounts [4], and finally fold changes between the condition were calculated by DESeq2 [7] (see galaxy history). The volcano plot was drawn with the bioinfokit toolkit [8]. Significantly enriched genes, having a positive fold change above 0.584 and a p-value lower or equal 5%, are shown in blue. The significance thresholds are marked by gray-dotted lines. The ten most significant genes are highlighted with their name. Non-significant genes are colored in gray.

Article Snippet: We utilized a well-functioning and validate genome-wide mouse lentiviral CRISPR guide RNA library v2 (Addgene).

Techniques: Gene Expression, Transduction, CRISPR